- Разное

Белая калитва ростовская область фото: Изображения Белая Калитва — фотографии путешественников Белая Калитва, Ростовская область

Содержание

По факту схода цистерн в Белой Калитве возбудили дело :: Общество :: РБК

По факту схода цистерн с горючим и последующего пожара на станции Белая Калитва Ростовской области возбуждено уголовное дело Южным следственным управлением на транспорте СК РФ. Об этом РБК сообщил представитель по взаимодействию со СМИ Южного СУТ СК РФ.

Фото: ГУ МЧС РФ по Ростовской обл.

Дело возбуждено по части 1 статьи 263 УК РФ (Нарушение правил безопасности движения и эксплуатации железнодорожного, воздушного или водного транспорта).

В ночь на четверг, 9 мая, при заходе грузового поезда на станцию белая Калитва в Ростовской области произошел взрыв и сход вагонов с железнодорожного полотна. При взрыве одну из цистерн отбросило и повредило стену близлежащего жилого дома на уровне 6 этажа. После взрыва пожар распространился по составу поезда.

На территории Белой Калитвы был введен режим ЧС. Возгорание площадью 1,5 тыс. кв.м. было потушено в 7.15 утра.

В результате происшествия пострадали 27 человек, из них 13 госпитализированы, 2 находятся в реанимации. Взрывом и последующим пожаром были повреждены 53 цистерны, из которых 12 сгорели полностью. Сейчас следователи устанавливают все обстоятельства произошедшего.

Белая Калитва: памятники и архитектура

Посчастливилось мне в январе-феврале пару раз побывать в небольшом городке Ростовской области — в Белой Калитве. Наведался я туда не по воле туриста, любящего посещать небольшие города, а по весьма тривиальной причине — по делам туда приезжал.
Что примечательно, мои приезды в этот город разделило всего лишь 2 недели. Но вот погода за это время изменилась кардинально. Если в первый приезд город встретил меня обычной русской зимой — со снегом и отрицательной (хоть и небольшой) температурой, то второй приезд пришелся уже скорее на весеннюю погоду — на снег нет даже намеков, температура плюсовая, и даже ночной дождь присутствовал.

Белая Калитва — небольшой город, но местами очень симпатичный, с обилием одноэтажных (часто деревянных) частных домиков, с обилием памятников. К сожалению, оба раза я не брал с собой фотоаппарат — не думал, что будет свободное время для прогулок. Но жизнь показала иначе. И пришлось фотографировать на телефон, так что заранее извиняюсь за качество.
Вообще достопримечательности Белой Калитвы можно посмотреть за один день, максимум — за два.

Основная жизнедеятельность города протекает на Майдане. Нет, это не ругательство, это название одной из площадей города, его исторической части. Вот и мы с вами начнем прогулку отсюда, благо возле площади и памятников предостаточно.


                                                                                                Площадь Майдан

Как я уже сказал выше, именно с Майдана начинается история города. Ростовская область, как известно, казачий край. И Белая Калитва зародилась как станица Усть-Белокалитвинская — в 1703 году. Тогда по челобитью казаков Михайлы Никитина, Сысоя Ермолаева, Емельяна Дорогального со товарищи войсковым атаманом Екимом Филипьевым была подписана войсковая грамота, дозволяющая заселить новый городок в устье Белой Калитвы.


                                          Свято-Введенский храм

Спустя четыре десятилетия после заселения этих земель казаки построили в станице деревянную однопрестольную церковь. Освятили ее в честь Введения во храм Божией Матери. При церкви в 1866 году открылось церковно-приходское попечительство. В 1890 году 8 октября при храме открылась церковно-приходская школа. В самой станице было двухклассное министерское мужское училище и одноклассная министерское женское. Мужское открылось в октябре 1890 года, женское – в 1896 году. В скором времени Свято-Введенский храм уже не мог вместить всех молящихся и тогда станичное правление принимает решение строить новую каменную трехпрестольную церковь.

В 1904 -1905 годах в Белой Калитве (тогда станице Усть-Белокалитвенской) был построен каменный храм. Правый престол освятили в честь пророка Илии, левый – в честь святителя Николая, архиепископа Мир Ликийских, Чудотворца. В 30-е годы Свято-Введенский храм был закрыт и подвергся разрушению. С храма сняли купола и кресты, был утеряны иконостас, полностью разрушена колокольня. Во время Великой Отечественной войны в храме стали совершаться богослужения, но не надолго, в 1961 году церковь вновь закрывают, и в ней размещается дом пионеров. Возрождение Свято-Введенского храма совпало с празднованиями Тысячелетия Крещения Руси. В 1988 году здание возвратили православной общине и началась его реставрация. В настоящее время на приходе открыта библиотека православной литературы. Работает воскресная школа.

Рядом с храмом построена кампличка — памятник погибшим казакам всех войн.

Вид на кампличку и Свято-Введенский храм.

Ну а в нескольких десятках метров от камплички был установлен памятник жертвам репрессий на Дону. Памятник довольно необычный, поскольку преимущественная его часть выложена из камня-пластушки (стена с неровными краями), а впереди, в полный рост стоит казак. Справа от донского казака установлен памятный знак с надписью, о том, сколько и за что погибло невинных людей.

Памятник играет роль своеобразного напоминания-предупреждения потомкам о временах Гражданской войны и коллективизации, когда на Дону творились страшные вещи. Ведь после Октябрьской революции для казаков настали тяжелые времена. Донской Войсковой казачий круг постановил не признавать власть Советов. На Дону повсеместно шли антибольшевистские восстания казаков. Новая власть жестоко расправлялась с непокорными: расстреливали тысячами — не только мужчин, способных держать в руках оружие, а целые семьи. Не щадили и священников. Часть жителей были убиты, а их дома сожжены.

Рядом стоит памятник труженикам тыла, установленный не несколько лет назад.

На противоположной стороне площади,напротив этих памятников, расположен Белокалитвинский историко-краеведческий музей, открытый в сентябре 1998. Но само здание историческое: раннее в нем располагалась церковно-приходская школа.

Возле Майдана расположено множество интересных зданий. Жилые дома здесь были построены преимущественно до 20 века. Но сейчас многие из них переделаны и отремонтированы так, что свою историческую ценность утратили. И все же среди них интересные домики.
Например, интересно вот такое соседство домов.


Небольшой деревянный домик, а рядом — более современный, из кирпича, к тому же интересно раскрашенный.

А отойдешь чуть дальше — и встретишь вот такой домик.

Подойдешь к нему поближе — а здесь, оказывается, проживает ФМС России.

А вот здания, построенные в советское время гораздо менее симпатичны. Но и среди них можно найти выделяющиеся экземпляры.
Например, магазин «1000 мелочей» — привет из СССР.

А в этом здании раньше ремонтировали технику, а теперь здесь хозяйничает «Магнит». Но советская вывеска интересна.

Далее стоит переместиться к современному центру города: на Театральную площадь, которая мало отличается от подобных площадей других городов России — памятник Ленина, лавочки, голубые сибирские ели и клумбы с цветами.

Гораздо интереснее расположенное рядом с площадью здание городского Дворца Культуры.

Район Театральной площади -это еще один район скопления памятников и интересных зданий. Рядом с Дворцом Культуры расположен шахматный клуб — с еще советской вывеской.

С другой стороны от Дворца построена гостиница «Красная Шапочка» — довольно симпатичное здание.

При гостинице есть летнее кафе с чудесными фигурками.

Пройдешь еще метров 150 — и найдешь памятникам пограничникам.

А рядом — кофейню, примечательную своим названием.

Всего лишь в квартале от Дворца Культуры расположился спортивный центр Белой Калитвы: стадион

… и дворец спорта, перед котором — скульптура девушки-спортсменки.

Остальные памятники рассредоточены по городу. Их можно посмотреть, совершая прогулки по городу.
Здесь можно встретить «трех медведей» — скульптурную композицию, созданную под впечатлением от известной картины Шишкина «Утро в сосновом бору»: два медвежонка резвятся на стволе сломленного дерева, в то время как их мама смотрит в сторону. Фигуры медведей крепятся к плите, которая вкопана в землю, и по всей улице, где находится скульптура, установлены напольные вазы для уличных цветов. Кстати, эта композиция, посвященная животным, была установлена одной из первых в городе.

Памятник «Первой учительнице». Установлен в 1990-х годах.

Памятник погибшим в военных конфликтах.

Еще один храм — храм Державной иконы Божией Матери.

История храма начинается с 2002 года, когда состоялось первое приходское собрание местной православной организации Державной иконы Божией Матери города Белая Калитва.
В ноябре 2002 года было найдено помещение для временного храма, и первая служба состоялась 15 марта 2003 года, в день обретения Державной иконы Божией Матери.

16 января 2004 года был вырыт котлован и заложен первый камень и через три года храм был возведен. Строительные работы в церкви ведутся до сих пор и пока к росписи стен в храме ещё не приступали, иконостас временный. Здесь запроектирован духовно-просветительский центр Белокалитвинского благочиния.

Рядом с храмом можно заметить еще одну скульптуру. Это памятник «Дорогие мои старики».

Он появился в городе совсем недавно и посвящен всем бабушкам и дедушкам, которые прошли тяжелые годы войны. Памятник изображен в виде женщины с ребенком на руках и мужчины в военной форме, которые сидят на самодельной лавочке. Местные жители даже называют его «памятник бабушке и дедушке».

Так как я работу в отрасли строительства, то меня больше всего меня порадовал Памятник Строителям.

Нельзя не сказать и про архитектуру города. Так сложилось, что в городе образовались микрорайоны частных одноэтажных домов и многоэтажек, не пересекающихся друг с другом.
Некоторые частные дома я уже показалась. В целом для таких районов характерны следующие виды:

           

Многоэтажки выделяются необычными балконами. Причем как новые дома…

… так и более возрастные.

А еще есть застройка 3-х, 4-х этажными домами.

     

Фотографии городов — Белая Калитва

 

Белая Калитва являет собой небольшой город в Ростовской области, расположенный на берегу двух рек, Северский Донец и Калитва. Белую Калитву можно назвать одним из памятников казачества на Дону.   (78 фото)

Не смотря на маленькую численность жителей, которых чуть больше 40 тысяч, город довольно крупный, относительно Красного Сулина, где проживает примерно столько же человек. Расположилась Калитва в 170 км от Ростова-на-Дону.

В живописном месте, с красивой природой, на берегах реки Северский Донец, который является самым крупным притоком реки Дон. Кстати все на том же Донце находится небольшой но красивый поселок Усть-Донецкий.

Основан город еще 18 веке, как казачья станица. Тогда, в 1703 году Петр 1 удовлетворил просьбу казаков о создании хутора. Но свидетельства археологов позволяют сделать вывод, что первые поселения образовались здесь уже в 4 веке до н. э.

Городская площадь, всегда голодные голуби не дают детям скучать.

Статус города станица получила в 1958 году, но до сегодняшних дней сохранилась вся культура и атмосфера казачьего колорита. Во время Великой Отечественной войны город захватили, а при его освобождении, близ Белой Калитвы, был повторен подвиг панфиловцев. Воины красной армии захватили и удерживали высоту.

Площадь Ленина на фоне дворца культуры — Белая Калитва фото

Градообразующем предприятием является алюминиевый завод, выпускающий различного рода товары, начиная от посуды и заканчивая несущими конструкциями. Так же существуют и другого рода предприятия, большое количество ИП. Вообще чувствуется что в городе есть деньги.

Белая Калитва фото

В городе большое количество памятников. В основном казачьей тематики, многие из них просвещенны годам Великой Отечественной войны. Установлены два танка, один из них у памятника павшим войнам с вечным огнем.

В городе хорошо развит спорт. Есть спортивный комплекс (сейчас закрыт на ремонт), шахматный клуб, гребная база, 4 спортивные школы, лазертаг, пейнтбол и др.

Белая Калитва фотографии города

Несмотря на то что население в городе снижается, в целом Калитва продолжает развиваться. Так был построен целый микрорайон из девятиэтажный домов.

Стоит отметить что дети в шахматном клубе занимаются бесплатно.

Шахматный клуб в Белой Калитве

Белая Калитва встречает своим уютом и своеобразным колоритом. Большинство построек невысокие, вряд ли здесь можно встретить старые здания выше 3 этажей. Много деревянных казачьих домов, с разделением на «низы» и «верха».

Город богат не только рукотворными памятниками но и природными. Например знаменитые горы «Две сестры». Две полностью одинаковых возвышенности, находятся на берегу реки, представляя собой красивый природный памятник.

Вокруг гор существует множество легенд и историй. Говорят что Ванга упоминала про них и советовала ходить босиком.

Красивая природа в Белой Калитве

Люди в Калитве приветливые и добрые, простые в общении, но образованные. Можно удивиться, когда в общественном транспорте, женщина лет 60, с добрыми глазами пытается выяснить в какой центр тебе нужно, при этом ее крик раздается на весь автобус. С непривычки может показаться, что она сердится, но это не так, просто такая манера общения, громко разговаривают.

А в окрестностях Калитвы есть почти заброшенный хутор Дядин, он интересен тем что в нм выросли известные люди, учены и героя советского союза, но главное что здесь стоит храм.

Вокруг храма ходит множество историй. А в годы Великой Отечественной войны в него попал снаряд, но практически не разрушил храм. Уже многие годы его восстанавливают.

Храм в хуторе Дядин

Потрясающе красивое место.

В городе расположено несколько парков, один из них аттракционный.

Центр Калитвы в Советские годы.

Река Калитва

В одном из хуторов Белой Калитвы проходит традиционный ежегодный праздник «Каяльские чтения». На котором кроме праздничного концерта проходит реконструированный бой русских с половцами. Этот бой воспет в «Слове о полку Игоревом». Историки считают что сражения проходило именно здесь, в междуречье рек Калитвы и Быстрой.

Зима в Калитве всегда проходит на коньках. В нескольких местах на речке можно найти хоккейные поля и сыграть дружной компанией.

Еще одним природным памятником Калитвы является сосновый бор. Вековые сосны дают возможность с пользой прогуляться перед сном и подышать свежим воздухом, наполненным сосновым запахом.

В Калитве находится городской Парк. В котором живут и гуляют: лошадь, ослы, лебеди.

Так же существует постоянный зоопарк, в котором содержатся: медведи, волки, лисы, жираф, дикобраз, зайцы и другие.

Красивый вид открывается на набережной Северского Донца. Украшением которой является памятник «Григорий и Аксинья».

Это был красивый город — Белая Калитва.

Автор фотографий — Татьяна Михина.

Смотрите так же — Красный Сулин; х. Черников; Усть-Донецкий; х. Терновской; Семикаракорск.



Комментарии

Ростовская область, Белая Калитва — маленькая жемчужина большой страны

Что такое Калитва? Удивительно, но топонимы, вроде бы знающие ответы на все вопросы, не задумывались о значении этого слова до сороковых годов. И только М. Макаров, комментируя лексику господина Линде, заметил: слово, вероятно, состоит из двух «обрусевших» производных: коло (о) и Литва.

Действительно, в городе с таким названием до сих пор ловятся слова, имеющие явное литовское происхождение.На юге России есть даже город Белая Калитва. Ростовская область, карта которой отражает многообразие проживающих здесь народов, гордится этим небольшим, но славным городом.

Немного истории

На территории, которая называется Ростовской областью, проживает более миллиона человек. Белая Калитва, получившая статус города только в 1958 году, занимает далеко не первое место по численности населения. Но здесь есть уникальные памятники, один из которых известен на всю Россию.Это единственный в мире памятник героям Слова о полку Игоря. Основанный в 1970 году, он стал одной из жемчужин городского поселения. Этим памятником гордится вся Ростовская область. Белая Калитва известна и другими литературными произведениями. В городе давно «живут» Шолохов Аксинья и дед Щукарь, три Медведя из русской сказки и другие небольшие скульптурные формы. Скульптуры — одна из главных достопримечательностей Белой Калитвы. Те, что поменьше, украшают газоны и клумбы.Те, что побольше, устанавливают в садах и парках. Возле них назначают встречи, делают предложения руки и сердца. Скульптуры — важная часть городской жизни.

Однако не только памятники литературы Ростовской области известны. Белая Калитва — это тоже битва русских с половцами в 1185 году, которую пел Боян. Это — история казачества, непосредственно связанная со становлением города. Это — революция и гражданская война (здесь находился штаб Ворошилова).Это Великая Отечественная война. Полгода город был оккупирован фашистами, но успел полностью восстановиться и залечить раны. Однако город Белая Калитва Ростовской области знаменит не только своей историей.

Калитва сегодня

Первое, что бросается в глаза посетителям сегодня — это леса новостроек. Город постепенно уходит в степь, превращая зеленые насаждения в уютные жилые массивы. Как и вся Ростовская область, Белая Калитва участвует в нескольких жилищных программах.Однако развивающиеся современные районы хорошо гармонируют со «старым городом».

Белокалитвинцы любят свой парк, основанный еще в 19 веке в устье реки. Сегодня он носит имя В. Маяковского, а его архитектура отражает всю историю города. В парке есть тематические уголки и аттракционы, пляж на берегу Донца и современная набережная. С такой же любовью жители относятся к горе Караул, самой высокой точке города, Майдану, где стоит восстановленный Введенский храм, памятник жертвам репрессий, вырванных в степь «Кони» (скульптура С.П. Кала ченко).Рассказывать о городе можно долго. Это одно из красивейших мест, которыми так славится Ростовская область. Белая Калитва … Сюда стоит приезжать, потом снова и снова с удовольствием возвращаться в гостеприимный город.

Саванна Стиль Карта расположения Белая Калитва, затенение холма

Карты Ростовской области

Maphill — это коллекция изображений карт. Это изображение объединяет карту в стиле саванны с земным шаром с центром в Белой Калитве. Используйте кнопки под изображением, чтобы переключаться на разные типы карт.

Взгляните на Ростовскую область с другой стороны.

Каждый стиль карты имеет свои преимущества. Нет лучшего типа карты. Лучше всего то, что Maphill позволяет взглянуть на всю территорию Белой Калитвы с разных сторон.

Да, эта карта расположения в стиле саванны хороша. Но есть большая вероятность, что другие стили карты вам понравятся еще больше. Выберите другой стиль в приведенной выше таблице и посмотрите на Белую Калитву с другого ракурса.

Что делать, если вам понравилась эта карта?

Если вам понравилась эта карта Белой Калитвы, Ростовской области, Северного Кавказа, России, пожалуйста, не держите ее при себе.Дайте друзьям возможность увидеть, как выглядит мир, преобразованный в изображения.

Поделитесь этой картой расположения.

Используйте кнопки Facebook, Twitter или Google+, чтобы поделиться ссылкой на карту расположения Белой Калитвы. Maphill — это самая большая галерея карт в Интернете. Однако количество карт — не единственная причина посетить Мапхилл.

Бесплатная карта проезда Белой Калитвы.

Эта карта расположения Белой Калитвы в стиле саванны доступна в формате изображения JPEG.Вы можете встроить, распечатать или загрузить карту, как и любое другое изображение. Обогатите свой веб-сайт высококачественной графикой карт. Используйте кнопку Free map над изображением.

Есть что-нибудь еще, кроме этой карты?

Конечно, есть. Было сказано, что карты Maphill стоят тысячи слов. Но гораздо больше вы сможете испытать, посетив Белую Калитву.

Вдохновляйтесь.

Белая Калитва — это лишь небольшая часть Ростовской области, но тем не менее здесь есть что предложить и что посмотреть.Невозможно запечатлеть всю красоту на карте.

Бронирование гостиниц со скидкой.

Если какая-либо из карт Maphill вдохновит вас приехать в Белую Калитву, мы хотели бы предложить вам доступ к широкому выбору отелей по низким ценам и с отличным обслуживанием.

Благодаря нашему партнерству с Booking.com вы можете воспользоваться скидками до 50% при бронировании отелей во многих городах и населенных пунктах в районе Белой Калитвы.

Подробнее о стилях карт

Каждый тип карты предлагает разную информацию, и каждый стиль карты разработан для разных целей.Прочтите о стилях и картографической проекции, использованных на приведенной выше карте (Карта расположения в стиле саванны Белая Калитва, затенение холмов).

Карта в стиле саванны

Эта карта названа в честь зеленого цвета, используемого на карте. Саванна — это земля с очень небольшим количеством деревьев, но покрытая травой. Трава должна быть зеленой, как на карте Белой Калитвы выше.

Карта саванны также имеет затенение холмов. Затенение рельефа имитирует отбрасываемую тень на приподнятый рельеф, что помогает создать впечатление трехмерного пространства на плоской карте.

Картографическая проекция карты местности

Карта расположения Белой Калитвы объединяет две проекции: ортогональную азимутальную проекцию земного шара и простую географическую проекцию прямоугольной части карты. Географическая проекция имеет прямые меридианы и параллели, каждый градус широты и долготы имеет одинаковый размер на всей карте мира.

Ортографическая азимутальная проекция — это перспективная проекция с бесконечного расстояния. Он был известен египтянам и грекам более 2000 лет назад.Это дает вид Земли, видимой из космоса. Одновременно можно просматривать только одно полушарие. Глобус с центром в Белой Калитве кажется более реалистичным, чем любая другая проекция.

Нелли Кирман — Осенний пейзаж

«Осенний пейзаж» — пейзажная картина маэстро Нелли Кирман. О произведении искусства: ТЕХНИКА: масляная живопись. СТИЛЬ: Импрессионист, Современный Издание: Уникальное, подписанное Вес: примерно 2 кг. Картина без рамы.Рама: опционально Галерея «Снежная жемчужина» предлагает возможность повысить ценность этого произведения искусства, добавив великолепную деревянную современную итальянскую раму на ваш выбор. Мы также можем предложить очень особенный старинный отреставрированный каркас. Каркас может быть вырезан вручную с композиционным орнаментом и вручную нанесен водной позолотой 22 карата. Настоящее сусальное золото поверх румян с полировкой, а затем патинировано до соответствующей патины. Это немного увеличит цену, стоимость доставки и сроки доставки.Ее картины приносят эмоции счастья, любви, энергии и красоты, представленные огромной творческой силой ее таланта ». Уважаемые ценители искусства! Если вам нравится искусство маэстро Кирмана, нажмите на ссылку, чтобы подписаться на этого художника и художественную галерею «Снежная жемчужина», чтобы открыть для себя всех наших художников и прекрасные произведения искусства. Большое спасибо! мы ценим ваш интерес к нашей работе. Маэстро Кирман Нелли Викторовна, Родился в 1988 году. В 2010 году окончила факультет изобразительных искусств Южного федерального университета г. Ростова-на-Дону.В 2012 году окончила Харьковскую государственную академию дизайна и искусств, факультет теории и истории искусств, Украина. Член молодежного объединения Творческого союза художников России и Международной ассоциации изящных искусств при ЮНЕСКО. С 2016 года аттестована Национальным мастером Национального союза мастеров народного искусства Украины. Участник 8 персональных и более 60 международных, региональных, областных и городских выставок и пленэров. Удостоена I премии Президента Российской Федерации в национальном проекте «Образование» за 2011-2012 годы.В 2015 году удостоена I премии Президента РФ за серию работ «Искусство против войны». В 2018 году награждена знаком государственной награды — медалью «За заслуги перед искусством». В 2020 году она была удостоена премии Валерия Гегамяна. Картины находятся в музеях и частных коллекциях Украины, Америки, Франции, Англии, России и Словакии. Персональные выставки: — пгт. Зажнивки. Александровка, Кировоградская область, Украина, 2007, — Художественная выставка живописи, посвященная 130-летию со дня рождения искусствоведа, барона Н.Н. Врангель, Ростов-на-Дону, РФ, 2010 — «Искусство против войны», Ростов-на-Дону, РФ, 2015. — «Время и Стекло», Харьков, Украина, 2016. — «Монохром», Харьков, Украина, 2018. — «Мыстецкое знамя», Винница, Украина, 2020 г. — Выставка живописи в Винницком областном художественном музее, Винница, Украина, 2020 — «ЛЮБИМЫЕ МОТИВЫ», Харьков, Украина, 2020-2021 гг. Награжден: 1. Дипломант ФЦП «Дети России». Ростов-на-Дону, 2004 г. 2. Благодарности Областного Дома народного творчества «За сохранение и развитие самобытной культуры Дона».Ростов-на-Дону, 2007, 2008, 2010 и 2015 гг. 3. Почетная грамота Александровского районного музея (Украина) «За популяризацию искусства». 2007 г. 4. Лауреат международной художественной выставки «С Дона — Додому» в номинации «Юные таланты» Украина, г. Кировоград, 2009 г. 5. Диплом I степени Всеукраинской научно-теоретической конференции молодых ученых «Культурно-информационное обеспечение XXI века». Украина, Харьков, 2010 г. 6. 2 место по живописной культуре в раскрытии пленэрных пейзажей Крыма на областной выставке живописи «Мечтай, лети, живи» Ростов-на-Дону, 2012 г. 7.Гран-при областного фестиваля искусств «Донская палитра». Ростов-на-Дону, 2012 г. 8. Присуждена 1 премия Президента Российской Федерации за поддержку талантливой молодежи в рамках реализации приоритетного национального проекта «Образование» на 2011-2012 годы. 9. Удостоен I премии Президента РФ за серию работ «Искусство против войны» в 2015 году. 10. В 2018 году награжден знаком национальной награды — медалью «За заслуги перед искусством». 11. В 2020 году награжден Премией Валерия Гегамяна.Участие в выставках. 1. 1999 Городской конкурс рисунков «Порхающие цветы», Ростов-на-Дону. 2. 2002 Международная художественная выставка «От Дона до Тясмину», Александровка, Кировоградская область, Украина. 3. 2004 Областная олимпиада по изобразительному искусству «Дети одаренные», г. Ростов-на-Дону. 4. 2007 Областной фестиваль казачьего фольклора «Нет свободы больше Тихого Дона», г. Старочеркасск Ростовской области. 5. 2007 Персональная выставка живописи «Зажновки», Александровка, Кировоградская область, Украина.6. 2008 Областная выставка «Донская керамика. История и современность », Ростов-на-Дону. 7. 2009 Городская художественная выставка «Многонациональный Дон», Ростов-на-Дону. 8. 2009 Международная выставка «Кобзарев Весна», Ростов-на-Дону. 9. 2009 Международная художественная выставка «200 рокив М. Гоголя», Ростов-на-Дону. 10. 2009. Фестиваль «Город мастеров» на Международных Каяльских чтениях, Б. Калитва. 11. 2009 Международная выставка «От Дона — Додому», Кировоград, Украина. 12. 2009 Городская художественно-этнографическая выставка «Мы — славяне», Ростов-на-Дону.13. 2009 Областной фестиваль искусств «Донская палитра», Ростов-на-Дону. 14. 2009 Областная выставка мастеров декоративно-прикладного искусства «Живая керамика», г. Ростов-на-Дону. 15. 2009 10-я юбилейная выставка Творческого Союза художников, Ростов-на-Дону. 16. 2010 Персональная выставка живописи, посвященная 130-летию со дня рождения искусствоведа, барона Н. Н. Врангеля, Ростов-на-Дону. 17. 2010 Лауреат выставки «Молодые художники Дона — 2010», г. Ростов-на-Дону. 18. 2010 Областная выставка «Арт-Ростов», Ростов-на-Дону.19. 2010 Международная художественная выставка картин Российско-Белорусского творческого объединения художников «Наше Отечество: Россия — Беларусь», Ростов-на-Дону. 20. 2011 Художественная выставка живописи «Молодые художники Дона 2011», Ростов-на-Дону. 21. 2011 Областная передвижная выставка живописи и скульптуры художников Дона, Шахты — Волгодонск — Пухляковка. 22. 2012 Областная выставка «Арт-Ростов», Ростов-на-Дону. 23. 2012 Выставка-конкурс молодых художников Дона «Мечтай, лети, живи», Ростов-на-Дону.24. 2012. I Международный художественный фестиваль «Слово полководца Игорево», Б. Калитва. 25. 2012 Областной фестиваль искусств «Донская палитра», Ростов-на-Дону. 26. 2013 Международный арт-фестиваль искусств «Слово полку Игореву», Б. Калитва. 27. 2013 Всеукраинский арт-проект «Маски на грани реальности», Донецк — Мариуполь — Краматорск. 28. 2013 Художественная выставка «Одесские рассказы», ​​Одесса. 29. 2013 Международный симпозиум «Мелодии степи и моря», Одесса (Вилково). 30. 2013 Областная художественная выставка «Молодые художники Дона — 2013», Ростов-на-Дону.31. 2014 Художественная выставка живописи «Молодые художники Дона 2014». 32. 2014 г Областная выставка «Арт-Ростов», г. Ростов-на-Дону. 33. 2014 Международный творческий фестиваль единства братских народов, посвященный 360-летию Переяславской Рады — воссоединения Украины и России, Ростов-на-Дону. 34. 2014 Международный фестиваль искусств и народного творчества «Шевченковская весна», посвященный 200-летию со дня рождения Т.Г. Шевченко, г. Ростов-на-Дону. 35. 2014 Международная групповая художественная выставка «Весенний калейдоскоп», Ростов-на-Дону.36. 2014 Всеукраинский проект «От любви к Украине», Харьков. 37. 2014 X Всероссийский фестиваль, посвященный Азову, Азов. 38.2014 ХLI Международный пленэр «Черногория — 2014» 39. 2015 Областная выставка «Арт-Ростов», г. Ростов-на-Дону. 40. 2015 Областная выставка Творчество народов Дона, Ростов-на-Дону. 41. 2015 Художественная выставка Творческого Союза Художников, Ростов-на-Дону. 42. 2015 Персональная выставка живописи «Искусство против войны», Ростов-на-Дону. 43. 2015 Международная выставка творческой группы «Лунный кот — Весенний силуэт», Ростов-на-Дону.44. 2015 Международная выставка Ростовского регионального отделения Общероссийской общественной организации «Творческий союз художников России», г. Ростов-на-Дону. 45. 2016 Художественная выставка творческой группы «Лунный Кот — Весеннее настроение», Ростов-на-Дону. 46. ​​2016 Международный арт-фестиваль «Слово о полку Игореве», Белая Калитва. 47. 2016 Международный фестиваль искусств и народного творчества «Шевченковская весна», Ростов-на-Дону. 48. 2016 Персональная выставка живописи «Время прошло», Харьков. 49.2016 Всероссийская художественная выставка «Искусство сегодня. Обнажение », Москва. 50. 2016 Художественная выставка творческой группы «Лунный Кот — Бест», Ростов-на-Дону. 51.2016 XVII отчетная художественная выставка Творческого союза художников г. Ростов-на-Дону. 52. 2016. Региональная выставка «Страна тайн», м. Кропивницкий, Украина. 53.2016 Всеукраинская художественная выставка ко Дню художника М. Харьков. 54. 2017 Всеукраинская художественная «Рождественская выставка», Харьков, Украина. 55.2017 «Древо познания», Киев, Украина. 56.2017 Отчетная художественная выставка Ростовского регионального отделения Общероссийской общественной организации «Творческий союз художников», г. Ростов-на-Дону. 57. 2017 Художественная выставка творческой группы «Лунный кот — Свой взгляд», Ростов-на-Дону. 58. 2018 Персональная художественная выставка «Монохром», Харьков, Украина. 59.2019 58-я Международная художественная выставка в Венеции — Венецианская биеннале — Национальный павильон Украины. 60. 2019 «День неторопливого искусства», пгт. Александровка, Кировоградская область, Украина. 61. 2019 Художественная выставка живописи «Золотой жук» Николаев, Украина.62.2019 Областная выставка произведений декоративно-прикладного искусства «Страна Мастеров», Кропивницкий, Украина. 63. 2019 «Лучшая работа года — 2019», Киев, Украина. 64. 2020 Всеукраинская художественная выставка «Очаровательное и вечное» Харьков, Украина. 65. 2020 Всеукраинская художественная выставка «Графика в Харькове», Харьков, Украина. 66. 2020 Персональная художественная выставка «Мыстецкое знамя» Винница, Украина. 67.2020 Персональная выставка живописи в Винницком областном художественном музее, Винница, Украина. 68.2020-2021 Персональная выставка живописи «ЛЮБИМЫЕ МОТИВЫ», Харьков, Украина. Работы художника находятся в частных государственных коллекциях по всему миру. Художественная галерея «Снежная жемчужина» предоставляет сертификаты подлинности на все ее работы.

Ростовская область (Россия)

Ростовская область (Россия)
Эта страница является частью сайта © FOTW Flags Of The World

Ростовская область

Последнее изменение: 29.07.2006 Антонио Мартинс
Ключевые слова: ростов-на-дану | ростов | донские казаки | дон |
Ссылки: Домашняя страница FOTW | поиск | отказ от ответственности и авторские права | напишите нам | зеркала




image by Олег Мысаков , 20 мая 2000 г.

См. Также: Другие сайты:

Презентация Ростовской области

( Примечание: Для корректного просмотра вам понадобится программа с поддержкой Unicode и шрифт кириллический текст на этой странице.Смотрите здесь подробности транслитерации).

  • Имя (английский): Ростовская область • (русский): Ростовская область | Ростовская область
  • Столица: Ростов-на-Дону | Ростов-на-Дону • (английский): Ростов-на-Дану
  • Площадь: 100 800 км 2 (≅38 900 кв. Миль) • Население: 4 333 700 жителей в 2000 году
  • Статус: Регион ( область | область) в Российской Федерации
  • Федеральный округ: Северный Кавказ • Экономический район: Северный Кавказ
  • Код номерного знака: 61 • Код радиолюбителя: RO • Код ISO 3166-2: ROS
  • Флаг принят в 1996 г.10.10 • Герб принят неизвестен. дата

Обратите внимание, что хотя название города — Ростов-на-Дану, Область называется просто Ростовская область.
Антониу Мартинс , 18 февраля 1999 г.


Описание флага

Закон о флаге был принят 10 октября 1996 года. Флаг Ростовской области — представляет собой прямоугольное полотнище. из трех изометрических горизонтальных полос: верх — синий, средний — желтый и нижний — алый цвет. Такой флаг был разработан до сих пор. атаманом (казачьим атаманом) Красновым в 1918 году.Каждый цвет символизировал следующее: темно-синий — цвет Донской казак, желтые — калмыки, в состав которых входили в состав Войска Дона ( Войско Донское ), красный — иногородние жители. В 1996 году флаг Краснова был дополнен белой полосой, расположенной вертикально вдоль древка. По размеру это составляет 1/5 части ширины панели. Соотношение ширины флаг по его длине составляет 2: 3.
Олег Мысаков , 12.09.1996

Закон гласит: « siniĭ » (средний синий).
Антониу Мартинс , 20 мая 2000 г.


Герб

Ростов-на-Дону 1811 г. Герб: за бледно-лазурной башней. серебристый каменный соболь с окнами и воротами из них, с серебряным флагом, сальто-лазурью, летящей сверху, и накидывает кольчужное деми-пальто на лук, копье и стрела в сальтире, все серебро, и прямо серебряный меч увенчанный шлемом или.
Сантьяго Дотор , 18 декабря 1998 г.


Все, что ниже эта строка не была добавлена ​​редактором этой страницы.

Хромосомный анализ и анализ штрих-кода ДНК комплекса видов Polyommatus (Agrodiaetus) damone (Eversmann, 1841) (Lepidoptera, Lycaenidae)

Голотип.

(рис.), Мужской, ЖИРНЫЙ идентификатор процесса BPAL1393-12, поле # CCDB-03030_F03, инвентарный номер GenBank {«type»: «entrez-nucleotide», «attrs»: {«text»: «MW186966″, » term_id «:» 1922202181 «,» term_text «:» MW186966 «}} MW186966; Узбекистан, Самаркандская область, горы Нуратау, близ села Зармитан, 40,40 ° с.ш., 66,69 ° в.д. , 1300 м, 11–13 июня 1994 г., В.Лухтанов лег., Хранится в Зоологическом институте РАН (Санкт-Петербург).

https://binary.pensoft.net/fig/493752

Самцы Polyommatus ( Agrodiaetus ) iphigenides a, b верхняя сторона ( a ) и нижняя сторона b голотип P. ( A. ) iphigenides zarmitanus subsp. ноя c, d верхняя ( c ) и нижняя ( d ) P. ( A. ) ифигениды iphigenides , Таджикистан, Transalai Mts, село Шибе e, f верхняя сторона ( e ) и нижняя сторона ( f ) лектотипа P. ( A. ) iphigenides iphigenides , «Наманган», в Museum für Naturkunde, Humboldt-Universität zu Berlin г, h верхняя сторона ( г ) и нижняя сторона ( h ) лектотипа P. ( A. ) ифигениды melanius , в Museum für Naturkunde, Humboldt-Universität zu Berlin. Шкала шкалы: 10 мм.

COI последовательность штрих-кода голотипа.

ACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGGACATCCCTAAGAATTTTAATCCGTATAGAATTGAGAACT CCTGGATCCTTAATTGGAGACGATCAAATTTATAATACTATTGTTACAGCCCATGCATTTATTATAATTTTTTTTATAGTTA TACCTATTATAATTGGGGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCACCTGATATAGCCTTCCCCCGATTAAA TAATATAAGATTCTGATTATTACCGCCATCATTAATACTACTAATTTCCAGAAGAATTGTAGAAAATGGAGCAGGAACAGGA TGAACAGTTTACCCCCCACTTTCATCTAATATTGCACATAGAGGATCATCTGTAGATTTAGCAATTTTCTCTCTTCATTTAG CAGGAATTTCTTCAATTTTAGGAGCAATTAATTTTATTACAACTATTATTAACATACGGGTAAATAATTTATCATTTGATCA AATATCATTATTTATTTGAGCAGTAGGAATTACAGCATTATTATTACTTTTATCTTTACCTGTATTAGCTGGAGCAATTACC ATATTATTAACAGATCGAAACCTTAATACCTCATTCTTTGACCCAGCTGGTGGGGGAGATCCAATTTTATATCAACATTTA.

Паратипы.

39 мужчин, 14 женщин: Узбекистан, Самаркандская область, горы Нуратау, близ села Зармитан, 40,40 ° с.ш., 66,69 ° в.д. , 1300 м, 11–13 июня 1994 г., нога В. Лухтанова. 2 самца: Узбекистан, Кашкадарьинская область (старое написание: Кашкадарьинская область), Гиссарский хребет (запад), близ села Тамшуш, 38.98 ° N, 67.35 ° E , 1800 м, 18–20 июня 1994 г., нога В. Лухтанова . 20 мужчин: Узбекистан, Кашкадарьинская область (старое написание: Кашкадарьинская область), Гиссарский хребет (запад), близ села Тамшуш, 38.98 ° N, 67.35 ° E , 1800 м, 5–7 июля 1994 г., нога В. Лухтанова. 11 мужчин, 2 женщины: Узбекистан, Сурхандарьинская область (старое написание: Сурхандарьинская область), Гиссарский хребет (запад), Сангардак, 38.55 ° N, 67.50 ° E , 1600 м, 2 июля 1994 г., нога В. Лухтанова. 60 самцов, 21 самка: Узбекистан, Самаркандская область, Зеравшанский хребет, Аман-Кутан, 1800 м, 39.27 ° N, 66.90 ° E , 7 июля 1994 г., нога В. Лухтанова. 13 мужчин: Таджикистан, Согдийская область, Зеравшанский хребет, село Падждруд, 39.37 ° N, 68.03 ° E , 1300 м, 17 самцов, 13 самцов, 10 июня 1994 г. Все перечисленные паратипы депонированы в Зоологическом институте РАН (Санкт-Петербург). 5 мужчин: Узбекистан, [Джизакская область], Усматская волость, 1700 м, 30.06.1988, лег В. Чиколовец, в Государственном Дарвиновском музее, Москва. 15 мужчин: [Узбекистан], Аман-Кутан близ Самарканда, 20 июня 1938 г., лег. А. Цветаев, в Государственном Дарвиновском музее, Москва. 26 самцов, 1 самка: [Таджикистан], Хисар-Алай, Зеравшанский хребет, Фароб, 2000 м, 4 июля 1998 г., г.Д. Самодуров лег., В Государственном Дарвиновском музее, Москва. 1 самка: Таджикистан, Западный Гиссар, озеро Нофин, 2400, 17 июля 1993 г., нога С. Чуркина, в Государственном Дарвиновском музее, Москва. 32 мужчины: [Узбекистан], Аман-Кутан близ Самарканда, 15–25 июня 1938 г., лег. А. Цветаева, в Зоологический музей Московского университета, Москва ( ЗММУ ). 7 мужчин: [Узбекистан], г. Аман-Кутан близ Самарканда, 20–23 июня 1938 г., лег Г. Пашин, в ЗММУ . 2 самца: [Узбекистан], Аман-Кутан близ Самарканда, 27 июля и 5 августа 1937 г., А.Г. Пашина лег., В ЗММУ . 3 суки: [Узбекистан], Аман-Кутан близ Самарканда, 15–26 июня 1938 г., лег. А. Цветаев, в ЗММУ . 8 самцов: Таджикистан, Западный Гиссар, озеро Хазорчашма, 2800, 26 июля 1993 г., нога С. Чуркина; 1 самка: Таджикистан, Западный Гиссар, озеро Нофин, 2400, 17 июля 1993 г., нога С. Чуркина, в колл. Чуркин (Реутов, Россия). 2 кобеля, 1 сука: Узбекистан, Западный Гиссар, горы Байсун, Мочай, 1500 м, 26 июня 1980 г., нога В. Тузова, в колл. Тузов (Москва). 10 мужчин, 1 женщина: [Узбекистан], Аман-Кутан близ Самарканда, 19–23 июня 1938 г., А.Цветаев лег., В сб. Сочивко А. (Москва). 10 самцов, 1 самка: [Таджикистан], Гиссар-Алай, Зеравшанский хребет, Фароб, 2000 м, 4 июля 1998 г., Л. Николаевский лег., В сб. В. Калинин, Москва.

Описание.

Кобели. Переднее крыло длина 15–17 мм.

Верх. с приграничными пятнами, бахрома белая.

Нижняя сторона : Основная окраска передних крыльев светло-серая, нижний ряд размыт, но отчетливо виден; дискоидные штрихи черные, с белой каймой; постдискальные ряды черных пятен, окаймленных белыми, базальные черные пятна отсутствуют; окраска основания заднего крыла светло-серая, базальная область с сильным зеленовато-синим налетом между корнем крыла и базальными пятнами; базальные пятна маленькие, окаймленные белым, мазок диска менее заметен, чем на передних крыльях; постдискальный ряд черных пятен, окаймленных белыми, субмаргинальными и передними отметинами, сильными и отчетливыми; субмаргинальный ряд дистально окаймлен красноватыми лунками, более выраженными к анальному концу ряда; белая полоса неконтрастная, часто едва заметная или вовсе отсутствует, бахрома бледно-сероватые.

Гениталии. Гениталии самцов имеют структуру, типичную для других видов подрода Agrodiaetus (Coutsis 1986, Eckweiler, Bozano 2016).

Самки. (рис.) Переднее крыло длина 15–17 мм.

https://binary.pensoft.net/fig/493754

Самки Polyommatus ( Agrodiaetus ) iphigenides a, b верхняя сторона ( a ) и нижняя сторона b паратип P. ( A. ) ифигениды zarmitanus subsp. ноя c, d верхняя сторона ( c ) и нижняя сторона ( d ) P. ( A. ) iphigenides iphigenides , Таджикистан, Трансалайские горы, село Шибе. Шкала шкалы: 10 мм.

Верхняя сторона : Основная окраска коричневая с немного более темными жилками, присутствуют дискальные штрихи, субмаргинальные и передние отметины почти отсутствуют на передних крыльях и сильные и четко видимые на задних крыльях, передние черные пятна на задних крыльях, окаймленные оранжевыми лунками, бахрома беловатая.

Нижняя сторона : основной цвет и общий рисунок такие же, как у самцов, но более темный, коричневато-серый, зеленовато-синий базальный слой почти незаметен, белая полоса на задних крыльях четко видна, дистально увеличена, бахрома светло-сероватая.

Диагностика.

Новый подвид фенотипически отличается от наиболее сходных P. ифигениды iphigenides (рис.,) Нижней стороной заднего крыла, которое имеет более бледную и менее контрастную окраску.Белая полоса также тусклая и слабо выделяется на фоне крыла, часто редуцирована или отсутствует. То же самое можно сказать и о базальном зеленовато-синем суффузии: он тусклый и слабо выделяется на фоне крыла; его размер в среднем намного меньше, чем у P. ифигениды ифигениды . Как правило, он ограничен черными точками базального ряда, а в P. ифигениды iphigenides он обычно продолжается дальше в дистальном направлении, иногда до пятен дискального ряда.Сама суффузия имеет более зеленоватый оттенок, чем у P. ифигениды iphigenides (у последнего он более синий). У нового вида всегда есть черные точки базального ряда (хотя они и небольшие), а у другого вида они уменьшены.

Основные различия между видами по-прежнему заключаются в молекулярных признаках. Полиомматус ифигениды zarmitanus можно отличить от P. ифигениды iphigenides с использованием молекулярных маркеров из гена COI . Эти митохондриальные диагностические признаки находятся в следующих позициях в области штрих-кода COI : аденин (A) в позиции 22, цитозин (C) в позиции 132, гуанин (G) в позиции 180, цитозин (C) в позиции 286, гуанин (G) в положении 468, гуанин (G) в положении 468 и гуанин (G) в положении 627.

Новый подвид отличается от симпатрического (синтопического и синхронного) P. филлиды по молочно-синей (не зеленовато-голубой) верхней стороне крыла и белому опушению костальной области передних крыльев у самцов и светло-серому цвету нижней стороны крыла ( P. филлиды имеют характерный теплый розовато-серый цвет нижней стороны крыла). Он также отличается от P. филлиды диагностическим нуклеотидом гуанином (G) в позиции 627 области штрих-кода COI .

Переживание, эмоции и субъективность 2 sem — Psicologia Escolar

 Переживание и развитие ребенка: теоретические исследования в раннем возрасте.
детство. In Fleer, M., González Rey, F. и Veresov, N. (Eds). Переживание, эмоции и
субъективность: продвижение наследия Выготского. Springer.
Хедегаард М. и Флир М. (2008). Изучение детей: культурно-исторический подход.
Мейденхед, Англия; Нью-Йорк, Нью-Йорк: Издательство Открытого университета.
Холодинский, М. (2009). Вехи и механизмы эмоционального развития.В Б.
Рёттгер-Росслер и Х. Дж. Маркович (редакторы), Эмоции как биокультурные процессы (стр. 139–
163). Нью-Йорк, штат Нью-Йорк: Спрингер.
Холодинский, М. (2013). Теория интернализации эмоций: культурно-исторический подход к
развитие эмоций. Разум, культура и деятельность, 20 (1), 4–38.
Холодинский, М., и Фридлмайер, В. (2006). Развитие эмоций и регуляция эмоций
(Международная серия Kluwer по информационно-просветительской стипендии). Нью-Йорк, штат Нью-Йорк: Спрингер.
Холодинский М., Сигер Ф.(2013). Актуальные и перспективные вопросы культурно-исторических исследований
об эмоциях: продолжение. Культура разума и активность, 20 (3), 288–297. DOI: 10.1080 / 10749039.
2013.807207
Холодинский, М., Сигер, Д., Кортас-Хартманн, и Вёрманн, В. (2013). Размещение регуляции эмоций
в рамках развития саморегуляции. В книге К. К. Барретта, Н. А. Фокса, Г. А. Моргана, Д.
Дж. Фидлер и Л. А. Даунхауэр (ред.), Справочник по процессам саморегулирования в развитии
(стр. 27–59): Taylor and Francis, 2012. Получено с https: // ebookcentral.proquest.com.
Леонтьев А. Н. (1978). Активность, сознание и личность. Энглвуд Клиффс, Нью-Джерси:
Прентис-Холл.
Клавир, Р., Лейзер, Д. (2002). Когда сходятся астрономия, биология и культура: детский
представления о днях рождения. Журнал генетической психологии, 163 (2), 239–253.
Кравцов, Г. Г., Кравцова, Е. Е. (2014). Проективный метод как основа непрерывного
образование. В А. Бландене (ред.), Совместные проекты. Лейден, Бостон: Брилл.
Кравцова, Е. Е. (2006). Представление о возрастных психологических новообразованиях в
современная психология развития.Журнал русского и восточноевропейского
Психология, 44 (6), 6–18. DOI: 10.2753 / RPO1061-0405440601
Кравцова, Е. Е. (2009). 2-я международная летняя школа Выготского: Полное погружение в Golden
Ключевая методика школы. Белая Калитва, Ростовская область, Россия: Институт Выготского, Русский
Государственный гуманитарный университет.
Кравцова, Е. Е. (2010). Неклассическая психология Выготского: двойственный характер позиции
Тема. Журнал русской и восточноевропейской психологии, 48 (4), 17–24. 10.2753 /.
Марта, С., & Флир, М. (2016). Сопереживание: Драматические события в сказках и пьесах.
Международные исследования в области дошкольного образования, 7 (1).
Мок Н. (Настоящий том). О концепции переживания: Вопрос для критического обзора. Во Флире,
М., Гонсалес Рей, Ф. и Вересов, Н. (Ред.), Переживание, эмоции и субъективность:
Продвижение наследия Выготского. Springer.
Ратнер, К. (2000). Культурно-психологический анализ эмоций. Культура и психология, 6 (1), 5–
39. DOI: 10.1177 / 1354067x0061001
126 С.Марч и М. Флир
Силкенбоймер Дж., Шиллер Э.-М., Холодинский М. и Кертнер Дж. (2016). Роль совместного регулирования
для развития социально-эмоциональной компетентности. Журнал саморегулирования и
Регламент, 2.
Вересов, Н. (1999). Неоткрытый Выготский: Этюды на предысторию культурно-исторического
психология. Франкфурт-на-Майне: Питер Лэнг.
Вересов Н. (Настоящий сборник). Концепция переживания в культурно-исторической теории: содержание и
контексты. В Fleer, M., González Rey, F. & Veresov, N.(Ред.), Переживание, эмоции и
субъективность: продвижение наследия Выготского. Springer.
Выготский, Л. С. (1966). Игра и ее роль в умственном развитии ребенка. Вопросы
Психологии, 12 (6), 62–76 (Оригинальная работа представлена ​​в лекции 1933 г.).
Выготский, Л. С. (1971). Психология искусства. Кембридж, Массачусетс: MIT Press (Оригинальная работа
опубликовано в 1925 г.).
Выготский, Л. С. (1982). Собрание сочинений. 2. Москва, Педагогика.
Вересов, настоящий том).
Выготский, Л. С. (1983). Собрание сочинений.3. Москва, Педагогика.
Вересов, настоящий том).
Выготский, Л. С. (1987). Мышление и речь (Н. Миник, Пер.). В Р. В. Рибере и А. С. Картоне
(Ред.), Собрание сочинений Л. С. Выготского (Том 1): Проблемы общей психологии.
(стр. 39–285). Нью-Йорк: Plenum Press (оригинальная работа опубликована в 1934 году).
Выготский Л. С. (1994). Проблема окружающей среды. В J. Valsiner & R. Van der Veer (Eds.),
Читатель Выготского (с. 347–348). Блэквелл (оригинальная работа опубликована в 1935 г.).
Выготский, Л. С. (1997).История развития высших психических функций: Собрание.
работы Л.С. Выготского (Ред. Р. В. Рибера, М. Дж. Холла и Р. В. Рибера, Пер., Том 4). Новый
Йорк, Нью-Йорк: Пленум (оригинальная работа опубликована в 1931 году).
Выготский, Л. С. (1999). Учение об эмоциях: историко-психологические этюды. В R.
В. Рибер (Ред.), Собрание сочинений Л.С. Выготского (т. 6, с. 69–235). Нью-Йорк: Пленум
(Оригинальная работа опубликована в 1933 г.).
Запорожец, А. В. (2002). К вопросу о генезисе, функции и структуре
эмоциональные процессы у ребенка.Журнал русской и восточноевропейской психологии, 40 (2),
45–66 (Оригинальная работа опубликована в 1986 г.).
Биографии авторов
Сью Марч - научный сотрудник, преподаватель и кандидат наук на факультете.
образования, Университет Монаш. Ее диссертация посвящена сказкам как источнику для детей.
развитие в дошкольном образовании под руководством профессора Мэрилин Флир. Ее
Сфера научных интересов: сказки, игры, разновозрастные группы, развитие детей и раннее
детская наука и техника с использованием культурно-исторической теории.Мэрилин Флир Профессор Мэрилин Флир заведует кафедрой дошкольного образования.
в Университете Монаша, Австралия, и бывший президент Международного общества
для исследования культурной деятельности (ISCAR). Ее исследовательские интересы сосредоточены на обучении в раннем детстве и
развитие, с особым вниманием к педагогике, игре, культуре, науке и дизайну и
технология.
6 Роль воображения и ожидания… 127
Глава 7
Повседневное формирование семьи:
Источник развития эмоций
Регулирование у маленьких детей
Фейян Чен
Аннотация В этой главе основное внимание уделяется развитию у маленьких детей регуляции эмоций.
Ульция в повседневной семейной жизни.Корреляционные исследования регуляции эмоций у
лабораторные условия были доминирующими в этой области. Мало что известно о
развитие регуляции эмоций в натуралистических контекстах. В исследовании исследовано
как ежедневное взаимодействие родителей и детей создавало условия для развития
регулирование эмоций с культурно-исторической точки зрения. Всего 61 час видео
данные были получены из четырех семей в Австралии. Результаты показали, что формирование
повседневные семейные рутинные отношения между родителями и детьми способствовали
развитие регуляции эмоций.Утверждается, что коллективный процесс
формирование рутины является источником эмоционального развития маленьких детей.
регулирование.
7.1 Введение
Регулирование эмоций как часть социально-эмоционального развития играет важную роль
в раннем обучении и развитии детей (White 2008). Регулирование эмоций
определяется как «процессы, посредством которых люди влияют на эмоции, которые они испытывают,
когда они у них есть и как они испытывают и выражают эти эмоции »(Gross
1998, стр. 275). Развитие регуляции эмоций включает в себя различные аспекты,
например, переход от внешней регуляции эмоций к внутренней, то есть эмоции
саморегулирование (Thompson and Goodman 2010).Исследования в области регуляции эмоций резко возросли за последние 25 лет.
(Брутто 1999, 2008). Большинство эмпирических исследований ранней регуляции эмоций соответствуют действительности.
реляционные исследования (например, Cohen and Mendez 2009; Herndon et al. 2013) и кон-
канальный 

Станица Романовская (Ростовская область): история и современность

Путешествие в незнакомые места — это всегда приятные эмоции. Особенно, если перед поездкой у путешественника была возможность поинтересоваться местными достопримечательностями и историей края.Деревня Романовская (Ростовская область) — очень интересное место, где история тесно переплетается с сегодняшним днем.

Немного истории

Станица Романовская (Ростовская область) основана в 1613 году. Названа в честь села в честь взошедшего на престол М.Ф. Романова. Об этом свидетельствует даже запись в местной газете от 1 октября 1912 года.

Свое образование село начинало с небольшого казачьего городка Романовского. Сначала город был основан на правом берегу Дона.Но людям приходилось на два столетия переселяться с одного берега на другой и обратно, виной всему было постоянное изменение русла реки.

С 1840 года жители поселка окончательно селились на левом берегу реки. К началу ХХ века в селе насчитывалось 676 дворов, была открыта церковь, а также приходская школа и приходская школа.

Храм Михаила Архангела

Деревня Романовская (Ростовская область) известна своей церковью Св.Архангел Михаил. Его история насчитывает около четырех веков. После очередного переселения села, связанного с изменением русла, в 1846 году братья Стучилины построили деревянную церковь, для которой специально заказали и привезли из Петербурга иконостас.

В жизни прихожан он имел большое значение. Стоит упомянуть, что на территории Храма Святого Архангела Михаила действовала приходская школа, а затем открылась библиотека для местного населения.

Местная набережная

Среди множества туристов, интересующихся Донскими казаками, хорошо известна станица Романовская (Ростовская область). Отдых в этих краях считается своеобразным, с уклоном на старинные казачьи традиции.

Добавить комментарий

Ваш адрес email не будет опубликован.